[#398787] Beginner Help - Encoding error exporting/writing to CSV — "Allan A." <lists@...>
I've looked all over the internet and can't seem to figure out what I
Can you show us the code? It would be easier to help.
[#398788] Constructor or a Method — Rubyist Rohit <lists@...>
Take for instance this code:
On Saturday 01 September 2012 Rubyist Rohit wrote
> Note that both the method definitions are useless here, as using
[#398797] What makes Ruby a dynamic language? — Rubyist Rohit <lists@...>
I am reading from time to time in several books that Ruby is a dynamic
On 2012-09-01, at 14:07, Rubyist Rohit <lists@ruby-forum.com> wrote:
2012/9/1 Uwe Kubosch <uwe@kubosch.no>
[#398810] Ruby module to get df -h output — Fosiul Alam <lists@...>
Hi
[#398833] How to get part of a string — Fosiul Alam <lists@...>
HI
[#398835] capture system command output — Fosiul Alam <lists@...>
Hi
On 2012-09-02 22:06, Fosiul Alam wrote:
> $?'s class is Process::Status
[#398844] Looking for patterns in a collection — Rainer Thiel <lists@...>
Greetings, i have the following (fragment olny) :
[#398848] Gem Install Nokogiri Newb — Benedict Wong <lists@...>
Hey guys, would really appreciate your help, I'm a complete noob with
[#398852] Extract # Number from a string — Erez Ben shoham <lists@...>
Hi
[#398883] need help to get output — Ferdous ara <lists@...>
Hi
[#398896] how to sum element of array — Edward QU <lists@...>
dear all
Edward QU wrote in post #1074559:
Padma J. wrote in post #1076389:
On Mon, Sep 17, 2012 at 9:27 PM, Padma J. <lists@ruby-forum.com> wrote:
[#398906] Socket Decorator — Bernhard Brodowsky <lists@...>
Hi, I am implementing a special kind of socket that takes an io object
On 09/04/2012 07:34 AM, Bernhard Brodowsky wrote:
[#398908] How to get unicode support in ruby — "nandan k." <lists@...>
Hi All,
[#398909] faster CSV process only one row! — ajay paswan <lists@...>
Suppose I have a string s, which is basically a CSV, how can I get it as
On Tue, Sep 4, 2012 at 3:25 PM, ajay paswan <lists@ruby-forum.com> wrote:
[#398910] Delete a line from a file — Ferdous ara <lists@...>
Hi
[#398936] best coding for limiting a value — Regis d'Aubarede <lists@...>
A) result=value<min ? min : (value > max ? max : value)
On Tue, Sep 4, 2012 at 10:13 PM, Regis d'Aubarede <lists@ruby-forum.com> wrote:
haha good one ;)
[#398949] Parsing Newb Help — Benedict Wong <lists@...>
Hey guys,
[#398962] Long calculation & time limit — toto tartemolle <lists@...>
Hello,
>If you want to know exactly what part of your program is taking a long
[#398964] Compiling ruby from source on windows — GPad <peterpan105105@...>
Hi to all,=0AI'm trying to compile ruby on my windows 7. I have already a r=
you already have visual studio installed?
Why do we need Visual Studios if we got Ruby? Is it a compiler issue? Will
Hi,=0AI have VS installed but the problem seems related to the generation o=
On Mon, Sep 17, 2012 at 2:04 AM, GPad <peterpan105105@yahoo.it> wrote:
[#398974] Newbie needs help — "Ken L." <lists@...>
Hi everyone,
[#398984] awk equivalent in ruby — Ferdous ara <lists@...>
HI
On Wed, Sep 5, 2012 at 2:19 PM, Ferdous ara <lists@ruby-forum.com> wrote:
[#398991] Ruby's Mark mechanism — Tridib Bandopadhyay <lists@...>
Hello
[#398997] OpenURI open method problem — "Derek T." <lists@...>
The code I am referring to looks like this:
If that's the case, is there a way I can follow the link all the way
[#399002] Parsing through downloaded html — Sybren Kooistra <lists@...>
Hi all,
Hi Ivan, thanks.
I've done similar job recently. I've copied part of code so look at it
"=D0=98=D0=B2=D0=B0=D0=BD =D0=91=D0=B8=D1=88=D0=B5=D0=B2=D0=B0=D1=86" <iv=
On 09/07/2012 03:29 AM, Michelle Col wrote:
Am 07.09.2012 09:28, schrieb Lars Haugseth:
Thanks Jesus.
[#399012] "Hiding" pictures(and source code if it's possible) — "Damián M. González" <lists@...>
Ey guys, how are you?
[#399029] Dotgeek Free Hosting for Learning Ruby — "dotgeekm d." <lists@...>
Hello Everyone,
[#399053] "Guess the random number" game — "Mattias A." <lists@...>
Hi guys!
Ahhh.. Its not easy to be a beginner... :P Thanks robert!!!
[#399072] How to patch ruby's gem before an install ? — David Unric <lists@...>
Hi,
Quoting David Unric <lists@ruby-forum.com>:
2012/9/7 David Unric <lists@ruby-forum.com>:
[#399083] regix in grep or something like this — Ferdous ara <lists@...>
Hi
Sorry.. is not it better to give the solution rather then pulling some
[#399110] Using ruby for scientific computing — Olivier Saut <osaut@...>
Hi all,
Hello,
[#399127] Match an ARray Element by if — sharmin malik <lists@...>
Hi
[#399141] Need help with my logic — sharmin malik <lists@...>
Hi Experts,
[#399157] Why does it work? (variable scope) — Iñaki Baz Castillo <ibc@...>
Two similar cases (same behavior):
[#399162] Export to CSV has array items under a single row — "Allan A." <lists@...>
I posted this issue over on StackOverflow but haven't received a reply,
On Mon, Sep 10, 2012 at 12:35 PM, Allan A. <lists@ruby-forum.com> wrote:
[#399164] Looking for advice on how to report performance issues — jason marshall <jdmarshall@...>
Hello,
[#399184] String iterate through regex matches with possition — Vicente Bosch <vbosch@...>
Hi,
[#399186] installing ruby gem — "Antonio A." <lists@...>
Hi everyone,
[#399189] About choosing Ruby? — "Mr. Bean" <lists@...>
I want to learn a programming langauge and I am stuck between Python and
[#399206] please help me with making script — Charmaine Willemsen <lists@...>
In this example i like to parse birthday and sexe
try modifying your XPath to use the following (worked for me using nokogiri)
[#399218] Pathname#to_str withdrawn in 1.9? — matt@... (Matt Neuburg)
Just getting started experimenting with Ruby 1.9 (1.9.3) and my scripts
Robert Klemme <shortcutter@googlemail.com> wrote:
It's definitely a judgment call. Not sure if this helps you, but I think
I'd hazard a guess that the reasoning is because the '+' behavior was
[#399227] Breaking Down the Block — incag neato <lists@...>
Can someone please explain in plain english how this block treats the
[#399244] ruby Range to array that acts like time objects? — "Jermaine O." <lists@...>
Hello everybody,
I'd create a class, maybe `class HoursMinutes`, which has @hour and
Sorry if my answer was a bit air-headed. Here's a more tangible example:
On Thu, Sep 13, 2012 at 1:54 PM, Matthew Kerwin <matthew@kerwin.net.au> wrote:
On Thu, Sep 13, 2012 at 08:31:44PM +0900, Jermaine O. wrote:
[#399265] inject is pathetic? — Dave Aronson <rubytalk2dave@...>
On Wed, Sep 12, 2012 at 11:46 PM, 7stud -- <lists@ruby-forum.com> wrote:
Dave Aronson <rubytalk2dave@davearonson.com> wrote:
On Thu, Sep 13, 2012 at 10:00 PM, Matt Neuburg <matt@tidbits.com> wrote:
Josh Cheek wrote in post #1075977:
[#399269] \b not working? — Cookie Rubster <lists@...>
Hi,
On 14 September 2012 09:24, Cookie Rubster <lists@ruby-forum.com> wrote:
[#399280] simple_gui_creator 0.2.0 released — Roger Pack <lists@...>
Hello all.
[#399283] want to get string between specialchars at endof the string — Lucky Nl <lists@...>
Hi friends,
The quick way to do that would be:
[#399293] Ruby on Ubuntu 12.04 LST — Bojan Jordanovski <lists@...>
Hello everybody,
Bojan,
[#399298] wow, YAML / Psych in 1.9.3 is *slow*! — matt@... (Matt Neuburg)
I just started trying Ruby 1.9.3, coming from Ruby 1.8.7, and was
[#399304] Ruby 1.9.3 and OS X Mountain Lion — sto.mar@...
Hi all,
Don't bother uninstalling. It'll just come back in updates.mapple leaves /us=
<sto.mar@web.de> wrote:
[#399324] using erb to generate a file — Dev Guy <devguy.ca@...>
Hey guys I am generating a file using erb and an input template file.
[#399327] how to write a array into a string — Edward QU <lists@...>
Hello all
[#399343] Class variables or Class singleton variables? — "Damián M. González" <lists@...>
Guys, how are you?
Are we aren't talking about the same thing?
I don't get what you mean. The singleton class of a class is obviously
On Sat, Sep 15, 2012 at 1:41 PM, Dami=E1n M. Gonz=E1lez <lists@ruby-forum.c=
Josh Cheek wrote in post #1076199:
On Sun, Sep 16, 2012 at 2:16 AM, Dami=E1n M. Gonz=E1lez <lists@ruby-forum.c=
[#399354] "Anonymous classes or modules", what are? (Marshaling) — "Damián M. González" <lists@...>
I'm trying to find out if is possible to serialize a class object, with
Dami=C3=A1n M. Gonz=C3=A1lez wrote in post #1076192:
Brian Candler wrote in post #1076224:
[#399369] Ruby, AI, Chatbots, Semantic Avatars and memory (persistence?) — Philip Rhoades <phil@...>
People,
There are a number of chatbots in Ruby out there but after I looked at
[#399386] Ruby - is it worth the effort? — neomex <neomex@...>
Hello,
Unfortunately with Ruby for me it's typically "fun and fast development"
Roger Pack писал 17.09.2012 22:06:
On Mon, Sep 17, 2012 at 8:20 PM, Peter Zotov <whitequark@whitequark.org> wr=
On 19 September 2012 09:24, Robert Klemme <shortcutter@googlemail.com> wrote:
On Wed, Sep 19, 2012 at 10:36 AM, Peter Hickman
> Was that 1.8.* or did you try that with 1.9.* MRI? What kind of
[#399396] Inline Assembly / Inline C — neomex <neomex@...>
Hello,
[#399398] Dir.mktmpdir doesn't remove it at exit? — Roger Pack <lists@...>
Hello.
Hmmm. IMO, the behaviour should be consistent, and not depend on whether
[#399421] Encoding question — Thomas Bednarz <lists@...>
I am new to ruby and play around with it a little bit at the moment. I
In the code example you used, there's no external encoding being
Nathan Beyer wrote in post #1076380:
On Thu, Sep 20, 2012 at 2:58 AM, Brian Candler <lists@ruby-forum.com> wrote:
Nathan Beyer wrote in post #1076883:
[#399436] Teaching a Class on Ruby — Brandon Weaver <keystonelemur@...>
Hey guys, I'm new to the list. I'm a Student Rubyist/Unix Hacker out of
[#399441] Bug or feature — Damjan Rems <lists@...>
There has probably been some discussion about this problem so sorry if I
On Tue, Sep 18, 2012 at 9:36 AM, Damjan Rems <lists@ruby-forum.com> wrote:
Robert Klemme wrote in post #1076432:
On Tue, Sep 18, 2012 at 8:44 PM, Damjan Rems <lists@ruby-forum.com> wrote:
[#399451] Class variables — Aleksander Ciesielski <neomex@...>
Is it obligatory to use instance variables in classes? Can't we just
[#399458] FloatDomainError while rounding — "raj g." <lists@...>
I am Trying to Round a number in my code which is as follows
Yes I have printed @den1 and @den2 but both of them are not same. even
[#399479] Ruby SQL Select Sum 2 Columns? — Courtney Fay <lists@...>
I have the following definition which is looking at an apache database,
[#399515] uninitialized constant VoiceSynth (NameError) — Aleksander Ciesielski <neomex@...>
Hello,
[#399523] behavior of iterator methods — takanobu maekawa <lists@...>
Hi all,
[#399524] the behavior of iterator methods — ten ten <lists@...>
Hi all,
Some methods change objects in place, others return a changed object and lea=
[#399540] RubyWorld Conference 2012 — Shugo Maeda <shugo@...>
Hello,
[#399556] still learning by doing - connecting rooms in a game — "Sebastjan H." <lists@...>
Hi,
Henry Maddocks wrote in post #1076876:
Could you be so kind as to suggest another book? I mean there are many
Sebastjan H. wrote in post #1076909:
Ok just a few points on the code that you did write.
Peter Hickman wrote in post #1076973:
Sebastjan H. wrote in post #1078385:
Jan E. wrote in post #1078392:
On Fri, Sep 21, 2012 at 12:02 AM, Henry Maddocks <hmaddocks@me.com> wrote:
Thank you all for recommending the reading and all the suggestions and
On Mon, Sep 24, 2012 at 8:46 PM, Sebastjan H. <lists@ruby-forum.com> wrote:
[#399558] Ruby Conferences for Students — Brandon Weaver <keystonelemur@...>
I'd love to be able to go to a Ruby conference, but 350$ is somewhat
[#399560] Re-throwing an exception — Jeff Tanner <lists@...>
Hi
[#399572] How would you allow variable from specific list of Fixnum? — Eliezer Croitoru <eliezer@...>
I have:
Hi,
Jan E. wrote in post #1076932:
On 9/21/2012 6:18 PM, 7stud -- wrote:
[#399577] ruby - remote method invocation — ajay paswan <lists@...>
How to start/run a ruby program in a remote machine in a LAN using a
[#399618] "percent-encoding" and "application/x-www-form-urlencoded" — Jeff Tanner <lists@...>
Hi
[#399623] Very important question - survey — Marc Heiler <lists@...>
Is matz more like a ninja or more like a samurai?
W dniu 2012-09-22 17:25, Marc Heiler pisze:
Ah and I was hoping no one would respond to this thread but as you
W dniu 2012-09-22 20:01, Peter Hickman pisze:
Welcome to the internet where facts are just a search away :) - if you
W dniu 2012-09-23 12:57, Peter Hickman pisze:
Yeah I was being a dick about it. Sorry about that
W dniu 2012-09-23 14:56, Peter Hickman pisze:
[#399641] Webframework that separates validation from persistence — Stefan Lang <perfectly.normal.hacker@...>
Is there a Ruby webframework that doesn't couple validation with persistence?
[#399646] sandwhich principle (ruby koans) — Roelof Wobben <rwobben@...>
Roelof,
[#399658] Insert at index — Geena Tho <lists@...>
Hi,
[#399683] beginner question. — "Samuel B." <lists@...>
I'm sure this has been asked before, but I was looking for some help.
[#399690] image processing — "Nicolò L." <lists@...>
I'm trying to build a program meant to recognize plants by looking at a
On 9/25/2012 3:40 AM, NicolL. wrote:
[#399695] inject problem — Roelof Wobben <rwobben@...>
Hi,
On Tue, Sep 25, 2012 at 11:31 AM, Jan E. <lists@ruby-forum.com> wrote:
The first parameter of the "inject" block is always the intermediate
You're iterating over the wrong object. After you've build the hash, you
[#399714] could initialize return an existing object instead of a new instance? — Gary Weaver <lists@...>
Is it possible for initialize to return an existing object instead of a
2012/9/25 Gary Weaver <lists@ruby-forum.com>:
Bartosz Dziewo=C5=84ski wrote in post #1077524:
2012/9/26 Gary Weaver <lists@ruby-forum.com>:
[#399726] Encoding issues... — Hal Fulton <rubyhacker@...>
I am playing more with encodings and having some problems.
[#399736] How To Rectify This Error? — "Kaushik Sharma L." <lists@...>
I am attaching my '.rb' file. Please check it. I am getting an error-
[#399750] Subclassing Date — "Damián M. González" <lists@...>
Ey guys, can't understand what's happening here:
Oh ok! now I'll have to seek another way, thanks for deal.
[#399754] Need Help With This Ruby Program!! — "Kaushik Sharma L." <lists@...>
I am attaching my '.rb' file. Please check it. I am getting an error-
Looks like the class needs the end. But, I only took a quick look.
The problem is the clean_number method and the print_numbers method
[#399756] Array Creation — Tridib Bandopadhyay <lists@...>
Hello
On Wed, Sep 26, 2012 at 3:21 PM, Tridib Bandopadhyay
Dave Aronson wrote in post #1077665:
On Wed, Sep 26, 2012 at 1:32 PM, Tridib Bandopadhyay
On Wed, Sep 26, 2012 at 3:47 PM, Tony Arcieri <tony.arcieri@gmail.com> wrote:
[#399761] Adding method on module class to yield and allow setting of attributes? — Gary Weaver <lists@...>
I have this Module:
> MyModule.configure do
7stud -- wrote in post #1077677:
[#399782] Need Help With 'Form Letters' In This Event Manager Project — "Kaushik Sharma L." <lists@...>
Hi friends I am not getting any idea of solving the Iteration 6: Form
Am 27.09.2012 07:17, schrieb Kaushik Sharma L.:
[#399795] subtract values of a array — Roelof Wobben <rwobben@...>
[#399811] Good book for getting started with Ruby? [I code Python!] — Alec Taylor <alec.taylor6@...>
I've learned programming in C++, Python and PHP at University. (also
Good question, there's many books about Ruby, now I'm apart from the
The Elegant Rubyist
[#399815] calcaulation with unknown numbers of numbers and options fail — Roelof Wobben <rwobben@...>
On Fri, Sep 28, 2012 at 9:40 AM, Roelof Wobben <rwobben@hotmail.com> wrote:
On Fri, Sep 28, 2012 at 10:18 AM, Roelof Wobben <rwobben@hotmail.com> wrote:
Hi,
[#399834] I need to know any way to read the values from a webpage table — Arup Rakshit <lists@...>
Hi,
[#399844] ibonacci sequence problem — Roelof Wobben <rwobben@...>
[#399846] Getting different results using Ruby IRB and files on method merge/code block — Carlos da Silva <lists@...>
When I run these two Ruby scripts I got two different answers. Also, if
[#399861] general newbie qustion — George Spak <lists@...>
Been working on Ruby for a few weeks now and am well on my way. I've
[#399875] : Letters 0.1.0 - A tiny debugging library — David Jacobs <david@...>
Hey guys,
Newbie needs help
Hi everyone,
I'm new to Ruby and am encountering a problem with an error message that
I don't quite understand. I am hoping someone more experienced can
explain where I have gone wrong. Any help would be much appreciated.
When I do not specify parameters, I get no errors:
ruby ~/Ruby_code/Align_against_reference.rb "temp.fastq"
"temp.alignment"
.........................done
Run options:
# Running tests:
......
Finished tests in 0.007649s, 784.4163 tests/s, 6144.5941 assertions/s.
6 tests, 47 assertions, 0 failures, 0 errors, 0 skips
But when I specify which lines of the file to process, I get the
following:
ruby ~/Ruby_code/Align_against_reference.rb "temp.fastq"
"temp.alignment" 0 40
..........done
/home/lok2/bin/ruby/lib/ruby/1.9.1/test/unit.rb:167:in `block in
non_options': file not found: 0 (ArgumentError)
from /home/lok2/bin/ruby/lib/ruby/1.9.1/test/unit.rb:146:in
`map!'
from /home/lok2/bin/ruby/lib/ruby/1.9.1/test/unit.rb:146:in
`non_options'
from /home/lok2/bin/ruby/lib/ruby/1.9.1/test/unit.rb:207:in
`non_options'
from /home/lok2/bin/ruby/lib/ruby/1.9.1/test/unit.rb:52:in
`process_args'
from /home/lok2/bin/ruby/lib/ruby/1.9.1/minitest/unit.rb:891:in
`_run'
from /home/lok2/bin/ruby/lib/ruby/1.9.1/minitest/unit.rb:884:in
`run'
from /home/lok2/bin/ruby/lib/ruby/1.9.1/test/unit.rb:21:in `run'
from /home/lok2/bin/ruby/lib/ruby/1.9.1/test/unit.rb:326:in
`block (2 levels) in autorun'
from /home/lok2/bin/ruby/lib/ruby/1.9.1/test/unit.rb:27:in
`run_once'
from /home/lok2/bin/ruby/lib/ruby/1.9.1/test/unit.rb:325:in
`block in autorun'
My script:
require("/home/lok2/Ruby_code/SeqRead.rb")
start = ARGV[2].to_i
stop = ARGV[3].to_i == 0 ? :eof : ARGV[3].to_i
fastq = FastxReader.new
fastq.readSingleEnd(ARGV[0], start, stop)
pL = DNA.new("TGC CGG AGT CAG CGT") # 5' -> 3' left primer
pR = DNA.new("AGT CAG AGT CGC CAC") # 5' -> 3' right primer
sm = {
'AA' => 1, 'AG' => 0, 'AC' => 0, 'AT' => 0,
'GA' => 0, 'GG' => 1, 'GC' => 0, 'GT' => 0,
'CA' => 0, 'CG' => 0, 'CC' => 1, 'CT' => 0,
'TA' => 0, 'TG' => 0, 'TC' => 0, 'TT' => 1
}
insert =
DNA.new("CTGTTCTCCCTACATCAAATGTCTATCCCCGCACCAAGTGGAGATTCCATGAGGATGAGG")
def align(reference, test, similarity_matrix, gapPenality=0)
aln = NW.new(reference, test, similarity_matrix, gapPenality)
if (aln.score == reference.length)
return aln
else
aln2 = NW.new(reference, test.rev_comp.reverse, similarity_matrix,
gapPenality)
end
temp =(aln.score > aln2.score) ? aln : aln2
return(temp)
end
temp = File.open(ARGV[1], "w")
alignments = fastq.reads.each do |read|
temp.puts ">" + read.readName
temp.puts "Sequence:"
temp.puts read.dna_seq
aln=align(insert, read.stripPrimers(pL, pR), sm, 0)
print "."
temp.puts "Alignment:"
temp.puts aln.display
temp.puts "Errors:"
temp.puts aln.errors
temp.puts "\n"
end
Here are the relevant parts from SeqRead.rb
class FastxReader
attr_reader :reads, :type
def initialize(type=:fastq)
@type = type
@reads = []
end
def readSingleEnd (fastx_file, startline=0, endline=:eof)
file = File.open(fastx_file, "r")
endline=File.foreach(fastx_file).inject(0){|c, l| c+1} if endline ==
:eof
(0...startline).each {|x| file.readline}
while file.lineno < endline && !file.eof? do
@reads << readRecord(file, @type)
end
file.close
end
def readPairedEnd (fastx_file_1, fastx_file_2)
fileA = File.open(fastx_file_1)
fileB = File.open(fastx_file_2)
while !fileA.eof? && !fileB.eof? do
readA = readRecord(fileA, @type)
readB = readRecord(fileB, @type)
@reads << PairedEndRead.new(readA, readB)
end
fileA.close
fileB.close
end
def readRecord(fastxFile, fileType=:fastq)
record = []
if fileType == :fastq
4.times {|x| record << fastxFile.gets.strip}
SeqRead.new(record[1], record[3], record[0].split("
").first).stripPrimer("N")
elsif filetype == :fasta
2.times {|x| record << fastxFile.gets.strip}
SeqRead.new(record[1], record[0]).stripPrimer("N")
else
throw ArgumentError
end
end
end
--
Posted via http://www.ruby-forum.com/.