From: Justin Collins <justincollins@...>
Date: 2013-02-19T23:51:08+09:00
Subject: Re: binding operator

On 02/19/2013 06:35 AM, rich berg wrote:
> Hi does ruby have a binding operator like perl  ?
>
> by using this RNA =~ s/T/U/g; you can you substitute T卒s with U卒s in
> perl can you do this as easily in ruby ?    if so how ?
>
> #!/usr/bin/env ruby
> # This is the basics of transcribing DNA into RNA
>
> # The DNA sequence
> DNA = "ACGGGAGGACGGGAAAATTACTACGGCATTAGC";
>
> # Print the DNA onto the screen
>
> print "Here is the starting DNA:\n\n";
>
> print DNA, "\n\n"
>
> # Transcribe the DNA to RNA by substituting all T's with U卒s.
>
> RNA = DNA;

This does not make a copy of DNA like you might be expecting, RNA and 
DNA point to the same string.

>
> RNA =~ s/T/U/g;
>
> # Print the RNA onto the screen
>
> print "Here is the result of transcribing the DNA to RNA:\n\n";
>
> print RNA, "\n";
>

While String#gsub will work, for this simple case you could just use 
String#tr (http://rdoc.info/stdlib/core/String:tr):

RNA = DNA.tr('T', 'U')


-Justin