[#403748] Why Array#include? not working withone liner integer arrays? — Arup Rakshit <lists@...>
I was trying to write a one liner with integer array using
On 01/31/2013 11:01 PM, Arup Rakshit wrote:
[#403770] Novice: self, @self.respond_to? and dynamically built methods — Steve Tu <lists@...>
I have been plodding through a Ruby tutorial and came across the
Am 01.02.2013 12:36, schrieb Steve Tu:
[#403794] Enumeration vs Enumerable — Arup Rakshit <lists@...>
Can anyone explain what "Enumeration" is? What it does and when a
Hello,
Calvin B. wrote in post #1094810:
[#403802] IRB equivalent to windows cmd if any? — Arup Rakshit <lists@...>
I am currently using ruby 1.9.3. But till now i am using windows command
[#403830] Confusion with Enum#with_index — Arup Rakshit <lists@...>
I was playing to understand the method "Enum#with_index" with the below
[#403837] Why none of the block giving the expected output with the "enumerator"? — Arup Rakshit <lists@...>
Why none of the block giving the expected output with the "enumerator"?
On Sunday 03 February 2013 Arup Rakshit wrote
Stefano Crocco wrote in post #1094918:
On Sunday 03 February 2013 Arup Rakshit wrote
Stefano Crocco wrote in post #1094920:
[#403846] Open file that its name given by STDIN.gets — aref aslani <lists@...>
Hi all. I'm following the Zed Shaw's ruby tutorials.
[#403856] Class for data analysis: File.open once — Soichi Ishida <lists@...>
ruby 1.9.3p362 (2012-12-25 revision 38607) [x86_64-darwin12.2.1]
[#403857] Easy way to handle positional and hashed parameters on a method? — tamouse mailing lists <tamouse.lists@...>
Ideally, I'd like to be able to offer either of these on an API I'm creating:
[#403869] Storing string-data in a module — Marc Heiler <lists@...>
Hi.
[#403870] Confusion with Enum#with_object block argument construct — Arup Rakshit <lists@...>
C:\>irb
the array at with_object collects the elements but:
Hans Mackowiak wrote in post #1095038:
On 4 February 2013 17:02, Love U Ruby <lists@ruby-forum.com> wrote:
Matthew Kerwin wrote in post #1095078:
[#403883] couldn't hit a button using selenium-webdriver — Arup Rakshit <lists@...>
**Code:**
[#403890] Can we open a page in a new tab in the same browser using selenium-webdriver? — Arup Rakshit <lists@...>
driver = Selenium::WebDriver.for :firefox
[#403891] BrowserCMS demo project creation problem — "Tom C." <lists@...>
I hope this is the place to post this. If it's the Rails list, let me
[#403914] Nokogiri scraping multiple URLs — Barry Kavanagh <lists@...>
I am new to Ruby and Nokogiri so excuse my lack of knowledge. I am
[#403920] Character classes use in Ruby — Love U Ruby <lists@...>
Can anyone help me by giving an explanatory example of each of the
my-ruby:
Hans Mackowiak wrote in post #1095104:
[#403935] How to stop page loading using selenium-web driver? — Love U Ruby <lists@...>
How to stop page loading using selenium-web driver?
[#403945] Nokogiri - Data output not as expected — Barry Kavanagh <lists@...>
Sorry for bothering the forum about this but it is extremely
Thank you for your explanation Jesus but I am just not sure where to
On Mon, Feb 4, 2013 at 5:01 PM, Barry Kavanagh <lists@ruby-forum.com> wrote:
[#403964] Will we have ruby 2.0 before 1.8 dies? — Marc Heiler <lists@...>
Hi,
[#403969] How to increase flexibility of #flatten — Tom Stut <lists@...>
I am trying to use flatten to change
[#403972] Ruby could recognize the values when putting into a webpage text filed. — Love U Ruby <lists@...>
SGksCgpJIGhhdmUgc29tZSB2YWx1ZXMgaW4gbXkgRXhjZWwgYXMgYmVsb3c6
how do you read the csv file?
Hans Mackowiak wrote in post #1095331:
I am just saying that the browser thinks the information it is receiving is
[#403975] Financial models using Ruby — Dwayne Henderson <its.code.in.here@...>
I'm working on this financial
[#403986] old syntax? what's going on here — tamouse mailing lists <tamouse.lists@...>
I have this in a _spec.rb file: (a gem I inherited at work)
Subject: old syntax? what's going on here
On Tue, Feb 5, 2013 at 7:47 AM, Carlo E. Prelz <fluido@fluido.as> wrote:
On Tue, Feb 5, 2013 at 7:52 AM, tamouse mailing lists
[#404005] Implementing DRY with a function call — Rob Marshall <lists@...>
Hi,
[#404006] using an instance variable inside a method — FirstName Surname <lists@...>
Hello.
I see, i thought that you could use these accessors only outside the
On 6 February 2013 07:26, FirstName Surname <lists@ruby-forum.com> wrote:
[#404014] Is there anyway to get all the class with their instance methods names to be available and to see th — Love U Ruby <lists@...>
Is there anyway to get all the class with their instance methods names
[#404021] Not able get the label text incurred with <input> element — Love U Ruby <lists@...>
I do have a below `HTML`:
The text is in the div, not linked to the checkboxes. Looks like poorly
why not try it yourself? or read what others say:
I think this should do it:
Joel Pearson wrote in post #1095530:
[#404025] Symbol.defined? — Student Jr <lists@...>
Symbol deserialization from external sources is now known to be
[#404041] Expanding gemspecs — Jon Cairns <lists@...>
Hi everyone, I've got a question about the existence or potential
[#404047] unicorn 4.6.0 - Rack HTTP server for fast clients and Unix — Eric Wong <normalperson@...>
Unicorn is an HTTP server for Rack applications designed to only serve
[#404058] Ruby 1.9.3-p362 on Mac OSX — Peter Bailey <lists@...>
Hi,
The following:
Jon Cairns wrote in post #1095548:
On Wed, Feb 6, 2013 at 7:48 AM, Peter Bailey <lists@ruby-forum.com> wrote:
On 6 February 2013 15:48, Peter Bailey <lists@ruby-forum.com> wrote:
Jon Cairns wrote in post #1095551:
[#404082] Problem building Ruby 1.9.3 patchlevel 385 under AIX 7.1 — Ruby Student <ruby.student@...>
Hello World!
Anybody there? Anybody at all!
On Thu, Feb 28, 2013 at 6:43 AM, Ryan Davis <ryand-ruby@zenspider.com> wrote:
[#404094] How to pass established/defined arrays into def method. — Tom Stut <lists@...>
I am trying to pass a defined array into a method. Ruby is interpreting
On Wed, Feb 6, 2013 at 7:25 PM, Tom Stut <lists@ruby-forum.com> wrote:
[#404101] Issues from an extreme beginner — Bruce Palmer <lists@...>
Hey guys, great to be part of such a great community! I look forward to
Ahh, thank you Matthew! That was just the push I needed!
On Wed, Feb 6, 2013 at 10:43 PM, Bruce Palmer <lists@ruby-forum.com> wrote:
Hassan Schroeder wrote in post #1095774:
On 8 February 2013 06:39, Bruce Palmer <lists@ruby-forum.com> wrote:
on the side-track in case the name has only one character then the word
[#404113] how to skip lines whenever there is an error? — Love U Ruby <lists@...>
Hi,
Love U Ruby wrote in post #1095742:
[#404123] Why the speed? — Jesper Bukkehave <lists@...>
Attention!! Noob warning :)
[#404127] Help with the following program please — "Wayne E." <lists@...>
Can anyone help me put this program together. It is crucial.
On Thu, Feb 7, 2013 at 5:30 PM, Wayne E. <lists@ruby-forum.com> wrote:
I was trying to see if I could get some help on a few of the smaller
[#404183] Best way to interact with samba — Mauro Mauro <lists@...>
Hi all,
> I need to move some files from a linux to a widnows machine.
[#404189] New to ruby - need assistance with rewriting a script — Ronald Craft <lists@...>
Hello,
[#404208] elegant way to determine if something is defined — tamouse mailing lists <tamouse.lists@...>
Something like:
Subject: elegant way to determine if something is defined
On Sun, Feb 10, 2013 at 7:39 AM, Carlo E. Prelz <fluido@fluido.as> wrote:
Subject: Re: elegant way to determine if something is defined
On Mon, Feb 11, 2013 at 8:05 AM, Carlo E. Prelz <fluido@fluido.as> wrote:
On Sun, Feb 10, 2013 at 4:09 AM, tamouse mailing lists
[#404211] Why doesn't Ruby have a built in sandbox class? — Ano Hito <lists@...>
After having some trouble getting the j-ruby sandbox gem to work
On Sun, Feb 10, 2013 at 10:45 AM, Ano Hito <lists@ruby-forum.com> wrote:
Robert Klemme wrote in post #1096190:
I posted a strawman for something similar a few days ago. It's a bit
[#404218] Ruby Equivalent to VB's "With"? — Joel Pearson <lists@...>
I've looked around but I couldn't find anything helpful on this,
[#404231] firtst and only element of array (noob level) — Ronnie Aa <lists@...>
Hello people,
Am 11.02.2013 13:27 schrieb "Ronnie Aa" <lists@ruby-forum.com>:
Thomas Preymesser wrote in post #1096273:
Subject: Re: firtst and only element of array (noob level)
Carlo E. Prelz wrote in post #1096281:
[#404235] The "ruby way" to do desktop applications? — "guirec c." <lists@...>
Hello,
I've built a few simple desktop apps using Ruby, Tk, and Ocra.
For exemple, I want to create an application to manage a small business.
Subject: Re: The "ruby way" to do desktop applications?
[#404238] Best books for "advanced" programmers — "guirec c." <lists@...>
Hello,
@Dave Aronson
Good Books on Ruby functional programing - any reference?
Not necessarily Ruby, but gets you in the mindset: The little Schemer
[#404242] Playing with DSLs, a question or two — Peter Hickman <peterhickman386@...>
I am playing around with writing some DSLs to help me get more familier
[#404245] Issue with Excel column values read. — Love U Ruby <lists@...>
Hi,
And how many select lists do you use which take floats?
Joel Pearson wrote in post #1096351:
Looking at your previous example list, you're right you have a mixture. But the
Wayne Brisette wrote in post #1096356:
If you already know it has to be an integer, use ".to_i", or "Integer()"
[#404262] RDoc in latest version — RKA <roshkins@...>
Hello Kind people in Rubyland,
I think this is just a different "skin" or "theme" for RDoc. The command-line interface and the data is still the same; it's just displayed in a prettier way.
[#404280] How to see the all keys of "RbConfig::CONFIG" ? — Love U Ruby <lists@...>
How to see the all keys of "RbConfig::CONFIG" ?
[#404312] text include, searching using a part of the word, storing the whole word if found — Horváth Alex <lists@...>
Hey guys,
[#404344] Ruby command line options s and S — Love U Ruby <lists@...>
Can anyone help me to understand the difference between s and S with
On Wed, Feb 13, 2013 at 3:59 PM, Love U Ruby <lists@ruby-forum.com> wrote:
"Jes=C3=BAs Gabriel y Gal=C3=A1n" <jgabrielygalan@gmail.com> wrote in pos=
WW91IGNhbiBzZWUgdGhlIGNvbnRlbnRzIG9mIHRoZSB2YXJpYWJsZSB1c2luZyBlY2hvOg0KDQog
[#404349] How to exit from the forever loop when using "-np" switch ? — Love U Ruby <lists@...>
I was trying to see the how they(-n,-p) works in ruby?
On Wed, Feb 13, 2013 at 4:55 PM, Love U Ruby <lists@ruby-forum.com> wrote:
Robert Klemme wrote in post #1096696:
[#404370] Confusion with Ruby command line options — Love U Ruby <lists@...>
Can any one help me to understand when and how to use the below two Ruby
[#404371] Error is coming with ruby commandline option "-d" — Love U Ruby <lists@...>
Hi,
That's simply what -d does =E2=80=93 it prints all exceptions that ever =
[#404372] file size of each item in file list — Sloan Ruby <lists@...>
I am trying to take the contents of a file which contains the results of
This is what I have now. I am not able to print out each line of the
On Wed, Feb 13, 2013 at 3:08 PM, Sloan Ruby <lists@ruby-forum.com> wrote:
[#404382] Can't load gems — Loran Kary <lists@...>
I have installed rvm on my Mac OSX and Ruby 1.9.3 and I also installed
Ryan Davis wrote in post #1096802:
[#404386] Re: Ruby command line options s and S — "D. Deryl Downey" <me@...>
Dude!
Humm!
Am 14.02.2013 09:15, schrieb Love U Ruby:
[#404387] Ruby Multithreaded producer-consumer problem — Abhijit Sarkar <lists@...>
Hi,
Bump!
On Sun, Feb 24, 2013 at 1:30 AM, Abhijit Sarkar <lists@ruby-forum.com> wrote:
First of all, Sean's modified version works!. It does not run into the
On Sun, Feb 24, 2013 at 4:51 PM, Abhijit Sarkar <lists@ruby-forum.com> wrote:
On Sun, Feb 24, 2013 at 4:23 PM, Robert Klemme
Subject: Ruby Multithreaded producer-consumer problem
Carlo E. Prelz wrote in post #1096828:
I rewrote the code using MonitorMixin and then back to using Mutex, same
Abhijit Sarkar wrote in post #1097009:
Love U Ruby wrote in post #1097084:
[#404407] Best DRY way to write bang versions of methods? — Joel Pearson <lists@...>
I've been wondering about the best way to quickly create a "bang"
[#404429] What are lambda functions used for? — Mike Glaz <lists@...>
I'm new to Ruby and lambda functions. I understand how they work but
[#404456] skip iteration in each loop — Saurav Chakraborty <lists@...>
I want to skip iteration for few values depending on dynamic condition.
[#404464] Ruby "visionary" code — Elr0ndK Asda <lists@...>
I found that code in the actual codebase of a web app I'm working on.
[#404485] Re: Ruby Multithreaded producer-consumer problem — "D. Deryl Downey" <me@...>
You don=92t get to start telling people that after all the un-googled,
D. Deryl Downey wrote in post #1097087:
I think he was talking to "Love U Ruby" not you...which means all of his
Ryan Victory wrote in post #1097122:
[#404491] so, what's the proper way to replace funcionality of GOTO ? — "Stu P. D'naim" <lists@...>
I need to make few scripts for tasks I do often manually, but last time
Stu P. D'naim wrote in post #1097111:
Love U Ruby: I'm really not sure what you meant by that response, but
Ryan Victory wrote in post #1097114:
I did consider jokingly showing the "enable jokes" compiler flag that
SSB0aGluayBHT1RPIGdldHMgYSBiYWQgcmFwLiAgQWN0dWFsbHksIEkgZmluZCB0aGUgQ09NRUZS
i recall the Amiga thrived on tons of GOTO 's
callcc is one way to do a functional programming style goto statement
Yeah, I realized that...still doesn't make him right :-)
Actually this makes him pretty much the definition of right.
Be careful saying "no one uses BASIC nowdays". I have no doubt there is
VGhlcmUgaXMgbm8gb25lIHdheSB0byByZXBsYWNlIEdPVE8uICBHT1RPIGlzIGF0IHRoZSBoZWFy
hash inside hash menus, interesting, same as Robert Klemme's example ...
[#404517] How do you associate the items of a collection instance with the collection in a smart Ruby way? — "Jesse F." <lists@...>
This is a conceptual question about Ruby. I think I may be thinking of
[#404528] Fun with finalizers — Garthy D <garthy_lmkltybr@...>
[#404533] Confusion with Ruby printing mechanics. — Love U Ruby <lists@...>
Here I just played to see how printing statement behaves with "nil"
[#404557] How the string concatenation operator hackes(modifies) the string contents of frozen array? — Love U Ruby <lists@...>
Hi,
humm, You are correct.
[#404560] makerakeworkwell 1.0.2 Released — Ryan Davis <ryand-ruby@...>
makerakeworkwell version 1.0.2 has been released!
[#404570] What is Ruby's default constructor? — Love U Ruby <lists@...>
Hi,
[#404628] Re: Adding camelize and underscore to String — tamouse mailing lists <tamouse.lists@...>
On Mon, Feb 18, 2013 at 12:07 AM, Rob Marshall <lists@ruby-forum.com> wrote:
On Mon, Feb 18, 2013 at 9:23 PM, tamouse mailing lists <
On Tue, Feb 19, 2013 at 4:45 AM, Josh Cheek <josh.cheek@gmail.com> wrote:
On Tue, Feb 19, 2013 at 10:57 AM, Robert Klemme
[#404632] Re: splat operator and Ruby instance variable assignments — Marc Heiler <lists@...>
Ok, understood what the guy wants ...
Marc Heiler wrote in post #1097736:
Ryan Davis wrote in post #1097840:
On 19 February 2013 20:35, Love U Ruby <lists@ruby-forum.com> wrote:
Peter Hickman wrote in post #1097848:
On 19 February 2013 21:22, Love U Ruby <lists@ruby-forum.com> wrote:
On Tue, 19 Feb 2013 22:37:59 +0100, Peter Hickman <peterhickman386@googlemail.com> wrote:
Always interesting when people bring out the proverbs
[#404668] variable editing in ruby (like zsh vared) — "R. Kumar" <lists@...>
I am redoing some zsh apps in ruby (commandline). One functionality was
[#404679] Python C API vs Ruby C API — Patrick <patrick@...>
Hi Everyone
[#404680] Fixnum: freeze status on ruby 2.0.0 rc2 — Enrico Rivarola <lists@...>
Hi,
[#404695] Instalation problem — "Carlos A." <lists@...>
HI!!
[#404696] THE CLASS/OBJECT CHICKEN-AND-EGG PARADOX — "Xavier R." <lists@...>
Hi,
Maybe you could provide more detail about what you are confused about. To
Matt Mongeau wrote in post #1098058:
It's not really a paradox. Take for example
Matt Mongeau wrote in post #1098076:
[#404697] Rdoc cannot find ruby files — Hakim Benbekhti <lists@...>
I am new to ruby and I am going through Peter Cooper=E2=80=99s book (Novi=
Thank you for the suggestion but no case sensitivity is not a problem.
[#404707] How meta class differs from real class ? — "Xavier R." <lists@...>
In Ruby-
I think I best understood this problem when trying to write my own
[#404738] backslash substitution — Mario Ruiz <lists@...>
don't know why... but this is not working
Subject: backslash substitution
Yes I know.. but i cannot change the string... the string it is like it
Subject: Re: backslash substitution
you mean by using gsub... in the expample i posted i tried but didn't
[#404747] Using Mechanize gem to automate some tasks on Facebook — Bao Trung Tran Nguyen <trannguyenbaotrung@...>
Dear friends,
[#404749] Questionable regex performance when using lazy matching and inverted character classes — "Tikhon B." <lists@...>
Hi All,
On Thu, Feb 21, 2013 at 12:12 PM, Tikhon B. <lists@ruby-forum.com> wrote:
Robert Klemme wrote in post #1098199:
On Fri, Feb 22, 2013 at 1:21 AM, Tikhon B. <lists@ruby-forum.com> wrote:
[#404757] Difference between pretty_print_cycle and pretty_print. — Love U Ruby <lists@...>
From the link I found the two methods :
[#404770] Class method's has a fuzzy meaning and a sharp meaning — "Xavier R." <lists@...>
David A. Black in his book - "The Well-Grounded Rubyist"
[#404809] Difference of 2 dates interms of years. — "Xavier R." <lists@...>
how can we get the experience years between two dates(ex:2012-01-11 to
Post some things you've tried.
How might you modify that to handle years?
Matt Mongeau wrote in post #1098486:
[#404817] Not able to understand the difference between "||=" and "|=". — "Xavier R." <lists@...>
>> a = []
On the same road I tried to the "&&=" as below :
On 02/22/2013 01:08 PM, Xavier R. wrote:
Justin Collins wrote in post #1098508:
[#404839] range is not assigning to the splat variable. — Love U Ruby <lists@...>
Why splat variable couldn't take in the below two code the "range" ->
Splat is an array, Rang is not an array.
On Sat, 23 Feb 2013 07:08:05 +0100, Matthew Kerwin <lists@ruby-forum.com> wrote:
On 23 February 2013 18:52, Bartosz Dziewo=C5=84ski <matma.rex@gmail.com> wr=
On Sat, 23 Feb 2013 13:44:25 +0100, Matthew Kerwin <matthew@kerwin.net.au> wrote:
[#404842] Why class returning its own name when "include" statement? — Love U Ruby <lists@...>
I was actually playing around with the class definition return values.
@Stefano Yes you are right. The below code is proved that.
On Feb 23, 2013 2:21 AM, "Love U Ruby" <lists@ruby-forum.com> wrote:
tamouse mailing lists wrote in post #1098808:
Am 23.02.2013 09:20, schrieb Love U Ruby:
[#404853] Regarding the instantiation relations in Ruby? — Love U Ruby <lists@...>
Is the below statement holds true in the course of instantiation
[#404867] how to see the class creation time in Ruby? — Love U Ruby <lists@...>
In Ruby any chance to see the last-modified time of a specific class?
Ohh! here I tried but none of them worked.
Xavier R. wrote in post #1098609:
[#404886] why "Range" not worked on "to_ary" ? — "Xavier R." <lists@...>
>> (1..9).to_a
[#404901] Confusion with `nil` value being produced by IRB in case of Array#size manipulation. — Love U Ruby <lists@...>
enum[int] =3D obj =E2=86=92 obj
its because ruby does not make a difference in Array#[] if the element
Hans Mackowiak wrote in post #1098729:
Am 24.02.2013 13:26, schrieb Love U Ruby:
Have you even tried to read the documentation???
unknown wrote in post #1098721:
[#404914] How to create a new database in ruby with sqlite3? — Hakim Benbekhti <lists@...>
Here is what I wrote on my Terminal. I tried different ways of writing
[#404921] How should I print only the last combination when using Array#combination(n) ? — Love U Ruby <lists@...>
>> a = [1,2,3]
a.combination(2).reverse_each.first #=> [2, 3]
On Sun, Feb 24, 2013 at 8:55 AM, Love U Ruby <lists@ruby-forum.com> wrote:
tamouse mailing lists wrote in post #1098785:
On Sun, Feb 24, 2013 at 9:15 AM, Love U Ruby <lists@ruby-forum.com> wrote:
see the below code :
[#404943] How to upgrade ruby to the latest version in ubuntu ? — Love U Ruby <lists@...>
@ubuntu:~$ ruby -v
you can use brightbox's ppa
Kiswono Prayogo wrote in post #1098865:
[#404956] RubyInstaller 2.0.0-p0 released — Luis Lavena <luislavena@...>
In combination with the rest of the RubyInstaller team, I'm very
On Sun, Feb 24, 2013 at 7:05 PM, Tim0 <tigre7t@gmail.com> wrote:
[#404969] Possible mruby bug in mrb_load_string — Garthy D <garthy_lmkltybr@...>
[#404981] Ruby String directives — "Kumar R." <lists@...>
Hi guys,
[#405000] no element found error with selenium-webdriver — Love U Ruby <lists@...>
For the below code I am getting error as "no element found"
[#405003] Help..Newbe to Ruby — "shaji n." <lists@...>
Greetings
Microsoft Windows XP [Version 5.1.2600]
[#405020] undefined local variable or method `m' — Love U Ruby <lists@...>
>> class Test
[#405025] Confusion with self within methods. — Love U Ruby <lists@...>
To see who is playing the role of `self` in `nested methods`, I tried
Doing more play with it I found the below code:
How about reading a Ruby book or two, or working through
[#405026] Please, help (GCD) greatest common divisor. — Caddy Tonks Lupin <lists@...>
Write a program to read two integers and show their greatest common
Best I could do on short notice:
On Tue, Feb 26, 2013 at 12:48 PM, Bartosz Dziewo=C5=84ski
Caddy:
Wayne Brisette wrote in post #1099174:
Don't you think you'd learn better if you actually tried to figure it
[#405032] Does 'gem list' go by .gemspec only? — Ron Lipke <lists@...>
Hello, Ruby beginner here trying to learn as much as I can.
[#405033] Get it on one line? — Patric Åberg <lists@...>
Hello pros!
[#405053] Programming Ruby 2.0 ? — "Jabari Z." <lists@...>
Has anyone heard about a Programming Ruby 2.0 edition coming out?
Yes, there's work going on. Dave Thomas asked some days ago on the
[#405059] Does this specific sound library exist? — Dirk Vogel <lists@...>
Hi there,
[#405067] Mac OS 10.8.2 and openssl — "Dr. Hegewald" <hegewald@...>
Hi everybody,
Subject: Mac OS 10.8.2 and openssl
Hi Carlo and all,
Subject: Re: Mac OS 10.8.2 and openssl
Hi Carlo and all,
Subject: Re: Mac OS 10.8.2 and openssl
On Wed, Feb 27, 2013 at 3:32 AM, Dr. Hegewald <hegewald@irmb.tu-bs.de> wrote:
[#405079] Why `10` not returned without the `return` from the block ? — Love U Ruby <lists@...>
CODE - I
But why mean to say when the below code works:
I seriously believe now that you are trolling this list. I, for one, am
[#405107] Object track llist for a particular class. — "Xavier R." <lists@...>
Say I have created more than one instances from a particular class as
Hash[local_variables.map {|k| [k,eval(k.to_s)]}]
Hans Mackowiak wrote in post #1099426:
[#405134] Match array1 with array2 — "Mattias A." <lists@...>
Hi,
[#405145] Discussion on Ruby's `alias` — Tukai Patra <lists@...>
>> class Foo
On 28.02.2013 12:34, Tukai Patra wrote:
[#405175] telnet - how to loop through commands listed in a file — Bob Ford <lists@...>
Let me first explain what I'm trying to do. I have written a very
Hmmm, The files are entered from the command line using a getopt (e.g -f
Am 05.03.2013 19:07, schrieb Bob Ford:
I've now run into a little conundrum. There is one command that can
Re: binding operator
On 02/19/2013 06:35 AM, rich berg wrote:
> Hi does ruby have a binding operator like perl ?
>
> by using this RNA =~ s/T/U/g; you can you substitute T卒s with U卒s in
> perl can you do this as easily in ruby ? if so how ?
>
> #!/usr/bin/env ruby
> # This is the basics of transcribing DNA into RNA
>
> # The DNA sequence
> DNA = "ACGGGAGGACGGGAAAATTACTACGGCATTAGC";
>
> # Print the DNA onto the screen
>
> print "Here is the starting DNA:\n\n";
>
> print DNA, "\n\n"
>
> # Transcribe the DNA to RNA by substituting all T's with U卒s.
>
> RNA = DNA;
This does not make a copy of DNA like you might be expecting, RNA and
DNA point to the same string.
>
> RNA =~ s/T/U/g;
>
> # Print the RNA onto the screen
>
> print "Here is the result of transcribing the DNA to RNA:\n\n";
>
> print RNA, "\n";
>
While String#gsub will work, for this simple case you could just use
String#tr (http://rdoc.info/stdlib/core/String:tr):
RNA = DNA.tr('T', 'U')
-Justin