From: rich berg <lists@...>
Date: 2013-02-19T23:35:15+09:00
Subject: binding operator

Hi does ruby have a binding operator like perl  ?

by using this RNA =~ s/T/U/g; you can you substitute T´s with U´s in
perl can you do this as easily in ruby ?    if so how ?

#!/usr/bin/env ruby
# This is the basics of transcribing DNA into RNA

# The DNA sequence
DNA = "ACGGGAGGACGGGAAAATTACTACGGCATTAGC";

# Print the DNA onto the screen

print "Here is the starting DNA:\n\n";

print DNA, "\n\n"

# Transcribe the DNA to RNA by substituting all T's with U´s.

RNA = DNA;

RNA =~ s/T/U/g;

# Print the RNA onto the screen

print "Here is the result of transcribing the DNA to RNA:\n\n";

print RNA, "\n";

-- 
Posted via http://www.ruby-forum.com/.