From: Cee Joe <cyril_jose@...>
Date: 2011-04-30T06:10:46+09:00
Subject: Re: File position and buffers

Hi Jake,

I would still need the header intact, which should be away from the rest 
of the entry:

>gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895), mRNA
AGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG

instead of:

">gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895),
mRNAAGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG>"

Still need the header line so I can extract information from that and 
the lines after that in each entry. Your delete() will delete all the 
newlines, which would not be beneficial in this scenario. Thanks for the 
input, appreciate it.

-Cee

-- 
Posted via http://www.ruby-forum.com/.