From: Cee Joe <cyril_jose@...>
Date: 2011-04-30T03:32:00+09:00
Subject: Re: File position and buffers

7stud -- wrote in post #995821:
> I suggest that people never use irb because it has too many quirks.
>
> The first thing you need to realize is that '>' is
> not the separator you want to look for.  That is the second bit of
> erroneous advice your mentor gave you.  That's because you don't care
> what character marks the beginning of every entry, rather you care what
> character marks the end of every entry.  The end of every entry in your
> file is marked by the string "\n\n", so you should use that as your
> input line terminator.  Remember, ruby uses "\n" for the input line
> separator by default, which means that when you read a file using
> IO#each, ruby reads lines--where the end of a line is marked by a
> newline.

I understand the logic, it makes sense. What if the file looked like 
this, where there is one newline seperating the entries? :

>gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895), mRNA
AGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG
>gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), mRNA
GTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATG
CGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG
>gi|3542945647|ref|NM_7453343.5Acc3| Def3 zgc:65895 (zgc:65895), mRNA
CGTGCGGGGABCCGTACGTGCCGTGGGGGTTTAATAGCGCGCCATCTGAGCAG
TTAGTCGCTGACGCATGCACG

Would an if-else(regarding"\n" and "\n\n") do the trick? I wanted to 
write my code to where it would handle both scenarios. Or maybe:

case
  when "\n\n"
    <code>
  when "\n"
    <code>
end

something to that extent? Suggestions?

-- 
Posted via http://www.ruby-forum.com/.