[#285488] Zed Shaw - Ruby has dodged a bullet — Chuck Remes <cremes.devlist@...>

Much like watching a car accident in slow motion, I could scarcely

96 messages 2008/01/01

[#285678] Windows Compilation Madness — Gary Wright <gwtmp01@...>

No point in keeping this discussion in the Zed thread...

24 messages 2008/01/02

[#285742] change the symbol in an interpolated string value? — scooterm@...

PROBLEM:

11 messages 2008/01/03

[#285784] Ruby install on Kubuntu Linux - why so spread out — Tom Cloyd <tc@...>

I've migrated from WinXP in recent days, and I'm having trouble getting

19 messages 2008/01/03
[#285786] Re: Ruby install on Kubuntu Linux - why so spread out — Casimir <pikEISPAMMMseli@...> 2008/01/03

Tom Cloyd kirjoitti:

[#285792] Re: Ruby install on Kubuntu Linux - why so spread out — Peter Hickman <peter@...> 2008/01/03

Casimir I'm going to have to call you on this. As you may have just

[#285838] "wrong number of arguments" What? I must be thick or somethi — ole __ <oliver.saunders@...>

class PermutationIterator

10 messages 2008/01/03

[#285873] Time.gm(1969) chokes on Windows — Tim Ferrell <s0nspark@...>

18 messages 2008/01/03

[#285910] Get your hands dirty: Help bootstrap Ruby on Windows. — Luis Lavena <luislavena@...>

This was asked, and asked, and asked too many times, so here we go.

20 messages 2008/01/03

[#285951] Finding if an array contains a data type — Sam Phoneix <dominicjefferies@...>

Say I wanted to see if an array contained a number or not. Would I use

11 messages 2008/01/04

[#285981] How to put a Ruby website online without rails — Softmind Technology <softmindtechnology@...>

Hi,

28 messages 2008/01/04
[#286230] Re: How to put a Ruby website online without rails — James Britt <james.britt@...> 2008/01/05

Giles Bowkett wrote:

[#286252] Re: How to put a Ruby website online without rails — yudi <yudi.xue@...> 2008/01/05

Ramaze looks good, gotta take a look. Thanks :-)

[#286449] Re: How to put a Ruby website online without rails — James Dinkel <jdinkel@...> 2008/01/07

Here is a forum post that tells you how to embed ruby script into

[#285988] problem with sockets — ian@...

Hi

13 messages 2008/01/04

[#286012] Studying Blackjack (#151) — Ruby Quiz <james@...>

The three rules of Ruby Quiz:

42 messages 2008/01/04

[#286056] Re: zed shaw zed shaw zed shaw — "Rick DeNatale" <rick.denatale@...>

On Jan 4, 2008 11:52 AM, Jeremy McAnally <jeremymcanally@gmail.com> wrote:

16 messages 2008/01/04

[#286077] DBI doesn't seem to install correctly on CentOS — Xeno Campanoli <xcampanoli@...>

I tried installing with the old tarfile sequence using setup.rb, as I

14 messages 2008/01/04
[#286079] Re: DBI doesn't seem to install correctly on CentOS — Joshua Schairbaum <joshua.schairbaum@...> 2008/01/04

Try this to use DBI with MySQL:

[#286120] Best Ruby book for experienced programmer — Kamil Chmielewski <kamilski81@...>

Hello,

19 messages 2008/01/04

[#286221] Vintage 0.0.1 - The super slim, micro web framework based on the idea of the old Merb — "Jeremy McAnally" <jeremymcanally@...>

Vintage is a very small web framework based on the original idea of

23 messages 2008/01/05
[#286346] Re: [ANN] Vintage 0.0.1 - The super slim, micro web framework based on the idea of the old Merb — "ara.t.howard" <ara.t.howard@...> 2008/01/06

[#286273] Marshal Pipe — "Carlos J. Hernandez" <carlosjhr64@...>

I've just re-discovered pipes.

16 messages 2008/01/05
[#286515] Re: Marshal Pipe — Eric Hodel <drbrain@...7.net> 2008/01/07

On Jan 5, 2008, at 15:37 PM, Carlos J. Hernandez wrote:

[#286374] DateTime new_offset unexpected results — Greg Go <plant@...>

Hello, everybody:

13 messages 2008/01/06
[#286484] Re: DateTime new_offset unexpected results — "Todd Benson" <caduceass@...> 2008/01/07

On Jan 6, 2008 2:04 PM, Greg Go <plant@ultraspace.com> wrote:

[#286375] Ruby's Kernel::exec (and system and %x) — JJ <jjnoakes@...>

I was reading about Kernel::exec (and the related Kernel::system

29 messages 2008/01/06

[#286473] Where do I put the ".to_f" ? — Peter Bailey <pbailey@...>

Hello,

13 messages 2008/01/07

[#286493] Bacon 0.9, a small RSpec clone — Christian Neukirchen <chneukirchen@...>

Hello,

13 messages 2008/01/07

[#286508] Embedding 1.9 — Dave Thomas <dave@...>

Folks:

18 messages 2008/01/07

[#286558] Thin 0.5.1 LOLCAT released — Marc-andre Marc <macournoyer@...>

Hey all,

13 messages 2008/01/08

[#286656] JRuby 1.1 RC 1 Released — Thomas Enebo <Thomas.Enebo@...>

The JRuby community is pleased to announce the release of JRuby 1.1 RC 1

19 messages 2008/01/08
[#286710] Re: [ANN] JRuby 1.1 RC 1 Released — "Sander Land" <sander.land@...> 2008/01/08

With all the blog posts about JRuby being posted, I thought I would

[#286696] dow ruby's strftime not attempt POSIX-compliance? — Jochen Hayek <jochen+ruby-forum@...>

Why is ruby's core class Time acting like this:

21 messages 2008/01/08
[#286701] Re: dow ruby's strftime not attempt POSIX-compliance? — Suraj Kurapati <snk@...> 2008/01/08

Jochen Hayek wrote:

[#286702] Re: dow ruby's strftime not attempt POSIX-compliance? — Suraj Kurapati <snk@...> 2008/01/08

Suraj Kurapati wrote:

[#286717] Re: does ruby's strftime not attempt POSIX-compliance? — Jochen Hayek <jochen+ruby-forum@...> 2008/01/09

Suraj Kurapati wrote:

[#287161] Re: does ruby's strftime not attempt POSIX-compliance? — Suraj Kurapati <snk@...> 2008/01/12

Jochen Hayek wrote:

[#287217] Re: does ruby's strftime not attempt POSIX-compliance? — Jochen Hayek <jochen+ruby-forum@...> 2008/01/12

Pls let me assure you in the beginning of this note,

[#287219] Re: does ruby's strftime not attempt POSIX-compliance? — Suraj Kurapati <snk@...> 2008/01/12

Jochen Hayek wrote:

[#287344] Re: does ruby's strftime not attempt POSIX-compliance? — Yukihiro Matsumoto <matz@...> 2008/01/14

Hi,

[#286742] why does this code leak? — ara howard <ara.t.howard@...>

cfp2:~ > cat a.rb

35 messages 2008/01/09
[#286991] Re: why does this code leak? — "=?ISO-8859-2?Q?Rados=B3aw_Bu=B3at?=" <radek.bulat@...> 2008/01/10

On Jan 10, 2008 10:15 PM, Robert Dober <robert.dober@gmail.com> wrote:

[#287063] Here Document syntax is stringent - trailing blank — Todd Burch <promos@...>

text = <<EOD

12 messages 2008/01/11

[#287067] Need command line to run a file 4 times — jackster the jackle <contact@...>

Hi Ruby Forum...

13 messages 2008/01/11
[#287074] Re: Need command line to run a file 4 times — Xavier Noria <fxn@...> 2008/01/11

On Jan 11, 2008, at 2:47 PM, jackster the jackle wrote:

[#287080] Counting the files in a directory.... — "Kyle Schmitt" <kyleaschmitt@...>

I'm writing some scripts to help manage a mail scanner used at my

18 messages 2008/01/11

[#287095] IRB Keyboard Input Issues — Oliver Saunders <oliver.saunders@...>

When I press the up arrow in IRB to access history I see this:

13 messages 2008/01/11

[#287188] Stream Parsing with REXML — Marc Hoeppner <marc.hoeppner@...>

Hi (again, sort of) :)

13 messages 2008/01/12

[#287190] Callable class with block — blondinet <jblondinet@...>

Hi everyone,

12 messages 2008/01/12

[#287199] Re: gem build documentation for new gems? — Eric Hodel <drbrain@...7.net>

On Jan 12, 2008, at 07:57 AM, Giles Bowkett wrote:

11 messages 2008/01/12

[#287226] Ruby from source on Leopard excruciatingly slow internet talk — "Chris Shea" <chris@...>

Just a couple of days ago I "upgraded" from Tiger to Leopard, and the

19 messages 2008/01/13

[#287282] regualr expression (need help) — Heinrich Piard <linux@...>

Hi all,

15 messages 2008/01/13

[#287368] regular expression — Johnathan Smith <stu_09@...>

hey

15 messages 2008/01/14
[#287371] Re: regular expression — "Robert Klemme" <shortcutter@...> 2008/01/14

2008/1/14, Johnathan Smith <stu_09@hotmail.com>:

[#287414] any tricks to speed up ruby? — Roger Pack <rogerpack2005@...>

31 messages 2008/01/14
[#287423] Re: any tricks to speed up ruby? — James Britt <james.britt@...> 2008/01/14

Roger Pack wrote:

[#287583] Re: any tricks to speed up ruby? — "M. Edward (Ed) Borasky" <znmeb@...> 2008/01/16

James Britt wrote:

[#287525] Overridding A Method Via A Mixin — Andrew Stewart <boss@...>

Hi Everyone,

17 messages 2008/01/15
[#287526] Re: Overridding A Method Via A Mixin — Robert Klemme <shortcutter@...> 2008/01/15

On 15.01.2008 18:32, Andrew Stewart wrote:

[#287666] ruby annoyances ... mine is line continuation, what's yours? — "scooterm@..." <scooterm@...>

Just thinking how really smart Ruby is in most areas makes it all the

11 messages 2008/01/16

[#287720] FXRuby or Shoes? — Doug Livesey <biot023@...>

Sorry I've posted this in the generic Ruby thread, but I wanted as

14 messages 2008/01/17

[#287735] LDAP Server not connected error — Varun Goel <varun.rajeshkumar@...>

hi all i made authentication function like this

12 messages 2008/01/17
[#287752] Re: LDAP Server not connected error — "Matt Todd" <chiology@...> 2008/01/17

Pluck out the actual LDAP code into IRB and see if it works. I've not

[#287757] Ruby syntax in "respond_to do |format| line -- can clarify? — Joshua Beall <jbeall.ruby@...>

Hi All,

12 messages 2008/01/17

[#287819] passing method references in python & ruby — "rpardee@..." <rpardee@...>

Hey all,

21 messages 2008/01/18
[#287897] Re: passing method references in python & ruby — "rpardee@..." <rpardee@...> 2008/01/18

On Jan 17, 8:12 pm, Justin Collins <justincoll...@ucla.edu> wrote:

[#287914] Re: passing method references in python & ruby — "=?ISO-8859-2?Q?Rados=B3aw_Bu=B3at?=" <radek.bulat@...> 2008/01/18

In python when you use method name without parenthesises you get

[#287917] Re: passing method references in python & ruby — Justin Collins <justincollins@...> 2008/01/18

Rados梶w Buウat wrote:

[#287989] Re: passing method references in python & ruby — Robert Klemme <shortcutter@...> 2008/01/19

On 18.01.2008 20:11, Justin Collins wrote:

[#288034] Re: passing method references in python & ruby — Justin Collins <justincollins@...> 2008/01/19

Robert Klemme wrote:

[#287869] Longest Repeated Substring (#153) — Ruby Quiz <james@...>

The three rules of Ruby Quiz:

62 messages 2008/01/18
[#287931] Re: Longest Repeated Substring (#153) — yermej <yermej@...> 2008/01/18

On Jan 18, 2:38 pm, Ken Bloom <kbl...@gmail.com> wrote:

[#287932] Re: Longest Repeated Substring (#153) — "=?ISO-8859-2?Q?Rados=B3aw_Bu=B3at?=" <radek.bulat@...> 2008/01/18

On Jan 18, 2008 10:00 PM, yermej <yermej@gmail.com> wrote:

[#287895] Thin 0.5.3 Purple Yogurt release — Marc-AndrCournoyer <macournoyer@...>

Hey all,

15 messages 2008/01/18
[#287962] Re: [ANN] Thin 0.5.3 Purple Yogurt release — "s.ross" <cwdinfo@...> 2008/01/19

This has been working so well on my Mac dev machine, I built it out on

[#287973] Re: [ANN] Thin 0.5.3 Purple Yogurt release — Bob Hutchison <hutch@...> 2008/01/19

[#287984] Re: [ANN] Thin 0.5.3 Purple Yogurt release — "s.ross" <cwdinfo@...> 2008/01/19

Got it up and running ... for a while. It's running as root/root and

[#287999] Re: [ANN] Thin 0.5.3 Purple Yogurt release — Marc-AndrCournoyer <macournoyer@...> 2008/01/19

Thin runs in a single thread, no need for a mutex there.

[#287953] Looking for code to determine length of audio files — "Rick DeNatale" <rick.denatale@...>

I'm working on a project which has the requirement to automatically

11 messages 2008/01/19

[#287971] Ruby with Mac OS X — Tj Superfly <nonstickglue@...>

Hello everyone,

22 messages 2008/01/19
[#287976] Re: Ruby with Mac OS X — "Hassan Schroeder" <hassan.schroeder@...> 2008/01/19

On Jan 18, 2008 8:37 PM, Tj Superfly <nonstickglue@verizon.net> wrote:

[#287978] Re: Ruby with Mac OS X — Tj Superfly <nonstickglue@...> 2008/01/19

She can't find the run file.

[#287979] Re: Ruby with Mac OS X — "Hassan Schroeder" <hassan.schroeder@...> 2008/01/19

On Jan 18, 2008 9:25 PM, Tj Superfly <nonstickglue@verizon.net> wrote:

[#287980] Re: Ruby with Mac OS X — Tj Superfly <nonstickglue@...> 2008/01/19

Hassan Schroeder wrote:

[#287985] Re: Ruby with Mac OS X — "s.ross" <cwdinfo@...> 2008/01/19

[#288000] Re: Ruby with Mac OS X — Tj Superfly <nonstickglue@...> 2008/01/19

Okay, we've got programs running!

[#288008] Re: Ruby with Mac OS X — "Windham, Kristopher R." <kriswindham@...> 2008/01/19

not sure what you are trying to do there..

[#288009] Re: Ruby with Mac OS X — Tj Superfly <nonstickglue@...> 2008/01/19

Well, I'm using it with arrays, here's a clip of the code that I'm

[#288133] Announcing Revactor: an Actor model implementation for Ruby 1.9 — "Tony Arcieri" <tony@...>

I'm pleased to announce the initial public availability of Revactor, an

25 messages 2008/01/21

[#288258] why must I initialize this variable? — matt@... (matt neuburg)

Here's a simple variable initialization / scope question. In the

14 messages 2008/01/22

[#288290] Determine where a method is being called from? — Ben Johnson <bjohnson@...>

Is it possible to determine if a public instance method is being called

11 messages 2008/01/22

[#288303] How to improve this code? — Jair Rillo Junior <jrjuniorsp@...>

Hi guys,

16 messages 2008/01/23

[#288308] Learning to build a MUD — Sean Dolbec <helbuns@...>

13 messages 2008/01/23

[#288348] Parsing HTML / following links etc — Dan Cuddeford <dancudds@...>

Hello all,

11 messages 2008/01/23

[#288391] Scripts run using load in "for" loop run out of order — Fa Sidd <siddiqifh@...>

Hi

13 messages 2008/01/23

[#288626] Making Change (#154) — Ruby Quiz <james@...>

The three rules of Ruby Quiz:

106 messages 2008/01/25
[#288653] Re: [QUIZ] Making Change (#154) — Dominik Honnef <dominikho@...> 2008/01/25

On [Sat, 26.01.2008 00:50], Ruby Quiz wrote:

[#288656] Re: [QUIZ] Making Change (#154) — "Jes俍 Gabriel y Gal疣" <jgabrielygalan@...> 2008/01/25

On Jan 25, 2008 9:53 PM, Dominik Honnef <dominikho@gmx.net> wrote:

[#288658] Re: [QUIZ] Making Change (#154) — James Gray <james@...> 2008/01/25

On Jan 25, 2008, at 3:09 PM, Jes俍 Gabriel y Gal疣 wrote:

[#288692] regular expression negate a word (not character) — Summercool <Summercoolness@...>

24 messages 2008/01/26

[#288773] Extracting Data from a Webpage — Tj Superfly <nonstickglue@...>

Hello everyone.

17 messages 2008/01/27

[#288847] Treetop parser (or PEG in general?) questions — Phrogz <phrogz@...>

I've been looking for something like treetop for a while now. Very

19 messages 2008/01/28

[#288916] Final Two Quizzes — James Gray <james@...>

As most of you know, we have two Ruby Quiz problems left (http://groups.google.com/group/comp.lang.ruby/msg/6f46393932c22e49

32 messages 2008/01/28
[#288978] Re: Final Two Quizzes — fedzor <fedzor@...> 2008/01/28

[#288980] Re: Final Two Quizzes — James Gray <james@...> 2008/01/28

On Jan 28, 2008, at 5:38 PM, fedzor wrote:

[#289016] Re: Final Two Quizzes — fedzor <fedzor@...> 2008/01/29

[#289026] Re: Final Two Quizzes — James Gray <james@...> 2008/01/29

On Jan 29, 2008, at 6:33 AM, fedzor wrote:

[#289048] Re: Final Two Quizzes — "Thomas Wieczorek" <wieczo.yo@...> 2008/01/29

Thank you for the many quizzes. I came to Ruby through a blog entry

[#289051] Re: Final Two Quizzes — James Gray <james@...> 2008/01/29

On Jan 29, 2008, at 3:23 PM, Thomas Wieczorek wrote:

[#289057] Re: Final Two Quizzes — Dominik Honnef <dominikho@...> 2008/01/29

On [Wed, 30.01.2008 06:34], James Gray wrote:

[#288973] Treetop Email Parser — Phrogz <phrogz@...>

(I would post this to the treetop mailing list...except there doesn't

14 messages 2008/01/28

[#289018] Proposal/RFQ: Hash#values/keys with block — "Dirk Traulsen" <dirk.traulsen@...>

Hi!

10 messages 2008/01/29

[#289046] newbie file write problem — Lars Zeb <larzeb@...>

This is my first attempt at ruby. I've written a class (SicCode) which

15 messages 2008/01/29

[#289060] For Loop question — Mark Mr <pimea.mark@...>

ok basically i cant quite figure out how to do a for loop i want in

13 messages 2008/01/29

[#289196] counting the number of repititions in an array — Adam Akhtar <adamtemporary@...>

Hi if i want to count the number of times values are repeated in an

10 messages 2008/01/30

[#289206] Ruby Puzzle Challenge — Wyatt Greene <greenewm@...>

Write a Ruby program that prints out the numbers 1 to 100, one number

14 messages 2008/01/30

[#289210] Learn how to program — "Regnum@... Regnum@..." <regnum@...>

Hi!, i want to learn how to program.Is ruby a good option?. Thanks.

30 messages 2008/01/30
[#289351] Re: Learn how to program — longint <michael.mello@...> 2008/01/31

On Jan 30, 4:30m, "Reg...@argentina.com Reg...@argentina.com"

[#289401] Re: Learn how to program — "Michael Bevilacqua-Linn" <michael.bevilacqualinn@...> 2008/02/01

IMHO,

[#289286] can ik make this more beautifull? — Remco Hh <remco@...>

nowadays i try to improve my coding style to produce nicer and beter

17 messages 2008/01/31

[#289355] Gedankenexperiment on method duck type safety — Tim Connor <timocratic@...>

*braces for the flames to follow*

13 messages 2008/01/31

[#289364] GUI for a newbie — Matthew Borgeson <hibridmatthias@...>

Hello All-

28 messages 2008/01/31

[#289375] how do you install a local gem? — 7stud -- <bbxx789_05ss@...>

Hi,

20 messages 2008/01/31
[#289378] Re: how do you install a local gem? — Stefano Crocco <stefano.crocco@...> 2008/01/31

Alle Thursday 31 January 2008, 7stud -- ha scritto:

[#289386] Re: how do you install a local gem? — 7stud -- <bbxx789_05ss@...> 2008/01/31

Stefano Crocco wrote:

[#289388] Re: how do you install a local gem? — Stefano Crocco <stefano.crocco@...> 2008/01/31

Alle Thursday 31 January 2008, 7stud -- ha scritto:

[#289398] Re: how do you install a local gem? — 7stud -- <bbxx789_05ss@...> 2008/02/01

Stefano Crocco wrote:

string extraction

From: Li Chen <chen_li3@...>
Date: 2008-01-10 20:38:54 UTC
List: ruby-talk #286979
Hi all,

What is the Ruby way to extract a string like this?

old_string="5'-AAAAAAAA    CCCCCCCC  TTT   GGGGG    GGGG-3'"
new_string="AAAAAAAACCCCCCCCTTTGGGGGGGGG"


Thank you very much,

Li
-- 
Posted via http://www.ruby-forum.com/.

In This Thread

Prev Next